LASSO Catcher Strand Generator

This tool designs catcher strands to be used with a new LASSOflex kit, or to supplement an existing riboLASSO kit, for the capture of your target RNA.

Used to label a single sequence. Ignored if your input uses FASTA headers.
Optional, for your own reference only. Nothing on this page is stored, sent, or kept.
Allowed bases: A, U (or T), G, C. Spaces and line breaks within a sequence are ignored. Paste multiple RNA targets in FASTA format (lines starting with >) to generate catcher strands for all of them at once.
Fixed anchor strand: GACGGCTCATAAGGCTCTAATC
Trying something different? If this tool doesn't support your use case, contact us with your email and a brief description of your problem to request a collaboration with a member of our team. If your target is DNA, including genomic DNA, you'd like to enrich samples instead of depleting them, or you're working with short-read or long-read RNA, we may be able to help design a custom solution for it.

Generated catcher strands will appear here.

Updated 24 September 2026.